Free Study Guides, Book Notes, Book Reviews & More...

Pay it forward... Tell others about Novelguide.com

A
Literary Analysis Test Prep Material Reports & Essays Global Studyhall Teacher Ratings Free Cash for College
Novelguide.com Novelguide.com Site Search:
New content - click here !


Discover!
Explore!
Learn...

Studyworld.com

Novelguide
Novelguide.com is the premier free source for literary analysis on the web. We provide an educational supplement for better understanding of classic and contemporary Literature Profiles, Metaphor Analysis, Theme Analyses, and Author Biographies.



CODIS: Combined DNA Index System

CODIS, or the Combined DNA Index System, is a database and electronic search engine that allows crime laboratories throughout the United States to exchange DNA information about criminals, suspects, and victims of crime. CODIS is operated by the U.S. Department of Justice through the Federal Bureau of Investigation.

The CODIS project began in 1990 as a collaboration among 14 forensic laboratories. The DNA Identification Act of 1994 authorized the use of DNA data for forensic analysis and formalized CODIS. By October 1998, CODIS became operational on a national level. As of 2004, all 50 states along with Puerto Rico, the U.S. Army and the FBI were CODIS participants.

CODIS has a three-tiered hierarchical structure. DNA information originates at the local level (LDIS, Local DNA Index System), where biological samples are taken at police departments and sheriffs' offices. Data from the LDIS then flows into the state (SDIS, State DNA Index System) and the national (NDIS, National DNA Index System) databases. SDIS provides a means for local crime labs within a state to exchange information. The NDIS allows for the exchange of DNA profiles on the broadest scale at the national level. The hierarchical nature of CODIS allows investigators to use their databases according to the specific laws under which they operate.

CODIS consists of two major indexes. The Forensic Index contains DNA information from the crime scene, including DNA information found on the victim. The Offender Index contains DNA profiles of convicted felons. Most states require all people convicted of sexual offenses, as well as many convicted of violent crimes, to provide genetic information to CODIS. As of December 2004, CODIS contained 2,132,470 DNA profiles. The large majority, about 2 million, were made up of DNA profiles from convicted offenders and were included in the Offender Index. The Forensic Index contained approximately 100,000 samples.

In addition, CODIS contains ancillary information that provides additional information for investigators to use in order to solve crimes. One index catalogues information collected from unidentified human remains and another collects DNA profiles voluntarily donated by the relatives of missing persons. CODIS also includes a population file consisting of anonymously donated DNA profiles. This file is used to quantify the statistical significance of a match.

Information entered into the Forensic Index from different locations in the United States can help link crimes together. For example, if the DNA profile taken from a crime scene in Tallahassee matches that taken from a crime scene in Miami, then there is evidence that the same person committed the crimes. This allows investigators to develop more leads and coordinate investigations. When a DNA profile from the Forensic Index matches one from the Offender Index, a suspect can be identified. After CODIS provides investigators with a potential match, experts in crime labs are always consulted for verification.

A DNA profile that is entered into CODIS consists of information that is gathered from stretches of the chromosome that are highly variable between different people. These variable regions are called polymorphisms. One type of polymorphism is a very short sequence of nucleotides, the building blocks of DNA, which repeats itself many times. This type of sequence is called a short tandem repeat, or STR. STRs are usually between two and five nucleotides long, and CODIS profiles specifically catalogue those that are four nucleotides long. STRs that are four nucleotides in length are referred to as tetramers. For example, the sequence of nucleotides "CGAACGAACGAACGAACGAA" represents five copies of the tetramer "CGAA." The number of times that "CGAA" repeats itself at a given location on the chromosome will vary from person to person. The CODIS core profile consists of STR information gathered from 13 different loci, or positions, on the chromosomes.

CODIS has been an extremely successful system that has aided in solving a variety of investigations. As of December 2004, CODIS produced more than 19,000 hits, which are defined as matches between suspect and crime that would not have been made without CODIS. CODIS has also assisted in solving 20,700 criminal cases in 47 states. Many of the investigations aided by CODIS have developed leads against sexual offenders. For example, in 1999, Virginia police received a phone call from a woman who had been stabbed and raped. By the time they arrived on the scene, the woman had bled to death. After gathering biological evidence from the woman's body, investigators developed a DNA profile of the suspect. Using CODIS, they produced a match in the Offender Index to a rapist who had been imprisoned in Virginia in 1989, but who had served out his term and been released. In another case, in 1996, two rapes occurred at in distant parts of St. Louis, both involving young girls who had been waiting at bus stops. The St. Louis Police Department was unable to solve the crimes. In 1999, they reanalyzed DNA evidence from the crimes and were able to generate a hit through CODIS to an offender in another rape case. He was eventually identified as the offender in both of the bus stop crimes. CODIS also played a role in the September 11, 2001 attacks. In the days following the attacks, the company that helped develop the CODIS software worked with the FBI and the New York Police Department to modify the software so that it could be used to identify the remains of those killed in the attacks.

CODIS: Combined DNA Index System

© 2006 Thomson Gale, a part of the Thomson Corporation.


Novel Analysis
About Novelguide
Join Our Email List
Bookstore - Buy Books
Contact Us





Oakwood Publishing Company:

SAT; ACT; GRE

Study Material






Copyright © 1999 - Novelguide.com. All Rights Reserved.
To print this page, please use Internet Explorer.
To cite information from this page, please cite the date when you
looked at our site and the author as Novelguide.com.
Copyright Information -- Terms Of Use -- Privacy Statement